Presentation laddar. Vänta.

Presentation laddar. Vänta.

D1S80 – exempel på genetisk markör för studier av människa Bioresursdagar för gymnasielärare Uppsala 18-19 november 2013 Ammie Berglund www.bioresurs.uu.se.

Liknande presentationer


En presentation över ämnet: "D1S80 – exempel på genetisk markör för studier av människa Bioresursdagar för gymnasielärare Uppsala 18-19 november 2013 Ammie Berglund www.bioresurs.uu.se."— Presentationens avskrift:

1 D1S80 – exempel på genetisk markör för studier av människa Bioresursdagar för gymnasielärare Uppsala 18-19 november 2013 Ammie Berglund www.bioresurs.uu.se

2 Laboration SYFTE: exempel på hur man kan arbeta med moderna biologiska metoder i genteknik och engagerande med analys av eget DNA. METOD: • DNA-extraktion från kindceller (Chelex-metod) • PCR för kopiering av D1S80-området • Gelelektrofores för analys av genotyper Ammie Berglund (ammie.berglund@bioresurs.uu.se)

3 Koppling till styrdokumenten Centralt innehåll Biologi 1 • Arvsmassans uppbyggnad, ärftlighetens lagar och mekanismer. Celldelning, DNA-replikation, mutationer • Genetikens användningsområden. Möjligheter, risker och etiska frågor • Evolutionärt perspektiv på molekylärbiologi Biologi 2 • Cell- och molekylärbiologins användningsområden Möjligheter, risker och etiska frågor • Enklare molekylärbiologiska metoder • Användning av genetiska data för studier av biologiska sammanhang Ammie Berglund (ammie.berglund@bioresurs.uu.se)

4 Genetiska data & genetiska markörer • Hela genom-DNA-sekvenser • Delar av DNA – gener & genetiska markörer • Lämplig nivå av variation? • Frågeställningen avgör! Jämföra arter? Jämföra populationer inom art? Identifiera individer? Jämföra gener? • Sekvensvariation – kräver sekvensering • Längdvariation – OK med gelelektrofores • D1S80 en variabel markör med längdvariation Ammie Berglund (ammie.berglund@bioresurs.uu.se)

5 Hur ser området D1S80 ut? locus D1S80 på kromosom 1 Ammie Berglund (ammie.berglund@bioresurs.uu.se)

6 Repeterade enheter Upprepade enheter om 16 baser Vanligaste nukleotidsekvensen hos en ”enhet” Ammie Berglund (ammie.berglund@bioresurs.uu.se)

7 Exempel på D1S80-alleler ABCDDECGHIKKIIHII HIJIILG (530 bp allel nr 24) GAAACTGGCCTCCAAACACTGCCCGCCGTCCACGGCCGGCCGGTCCTGCGTGTGA ATGACTCAGGAGCGTATTCCCCACGCGCCAGCACTGCATTCAGATAAGCGCTGGCT CAGTGTCAGCCCAAGGAAGACAGACCACAGGCAAGGAGGACCACCGGAAAGGA AGACCACCGGAAAGGAAGACCACCGGAAAGGAAGACCACAGGCAAGGAGGAC CACCGGAAAGGAAGACCACCGGCAAGGAGGACCACCGGCAAGGAGGACCACCA GGAAGGAGGACCACCAGCAAGGAGGACCACCAGCAAGGAGGACCACCAGGAAG GAGGACCACCAGGAAGGAGGACCACCGGCAAGGAGGACCACCAGGAAGGAGG ACCACCAGGAAGGAGGACCACCGGCAAGGAGGACCACCAGGAAGGAGAACCAC CAGGAAGGAGGACCACCAGGAAGGAGGACCACCAGGAAGGAGGACCACTGGCA AGGAAGACCACCGGCAAGCCTGCAAGGGGCACGTGCATCTCCAACAAGAC ABCDDECHHIIILG (370 bp allel nr 14) GAAACTGGCCTCCAAACACTGCCCGCCGTCCACGGCCGGCCGGTCCTGCGTGTGA ATGACTCAGGAGCGTATTCCCCACGCGCCAGCACTGCATTCAGATAAGCGCTGGCT CAGTGTCAGCCCAAGGAAGACAGACCACAGGCAAGGAGGACCACCGGAAAGGA AGACCACCGGAAAGGAAGACCACCGGAAAGGAAGACCACAGGCAAGGAGGAC CACCGGAAAGGAGGACCACCGGCAAGGAGGACCACCGGCAAGGAGGACCACC AGGAAGGAGGACCACCAGGAAGGAGGACCACCAGGAAGGAGGACCACTGGCAA GGAAGACCACCGGCAAGCCTGCAAGGGGC ACGTGCATCTCCAACAAGAC Ammie Berglund (ammie.berglund@bioresurs.uu.se)

8 Populationsanalyser av D1S80-variation Allel 18 och 24 vanligast Ammie Berglund (ammie.berglund@bioresurs.uu.se)

9 Lämplig markör för skolan? • Inte en proteinkodande sekvens • Inte kopplad till någon egenskap • Relativt enkelt separera alleler (16 bp skillnad) • Att känna till: deletionssyndrom & hemizygoti (”falsk homozygot” pga deletion) • Forskare i medicinsk genetik säger OK • Gör inga släktskapsanalyser! Ammie Berglund (ammie.berglund@bioresurs.uu.se)

10 Tänkbara frågeställningar • Är allelerna 18 och 24 de vanligaste för D1S80 i gruppen/klassen? • Hur stor variation i antal alleler och antal genotyper får vi i gruppen/klassen? Ammie Berglund (ammie.berglund@bioresurs.uu.se)

11 Exempel på resultat och tolkning av gel Här är BRUNNARNA! STORLEKSSTANDARD 100 bp (baspar) 200 bp (baspar) 300 bp (baspar) 400 bp (baspar) 500 bp (baspar) D1S80 ger DNA-fragment i storleksområdet 300-800 bp (baspar) Ammie Berglund (ammie.berglund@bioresurs.uu.se)

12 Linjär regression – verktyg för att bestämma storlek på DNA-fragmenten Storlek (bp) Avstånd (cm) log10 1000 2,7 0,431364 900 2,9 0,462398 800 3,2 0,50515 700 3,5 0,544068 600 4,2 0,623249 500 5,1 0,70757 400 6,3 0,799341 300 8 0,90309 200 10 1 100 13 1,113943 Vilken längd har DNA-fragmentet som ligger 6,7 cm från brunnen? 350 bp ??? Ammie Berglund (ammie.berglund@bioresurs.uu.se)

13 Log-diagram ger rätlinjigt samband Vilken längd har DNA-fragmentet som ligger 6,7 cm från brunnen? Beräkna log10-värdet för 6,7 = 0,826 Beräkna antalet baspar med hjälp av den linjära funktionen y = -1253,3*0,826 + 1438,6 = 403 bp Ammie Berglund (ammie.berglund@bioresurs.uu.se)

14 Vilka alleler har jag? 37014 38615 40216 41817 43418 45019 46620 48221 49822 51423 53024 54625 56226 57827 59428 61029 62630 64231 65832 67433 69034 70635 72236 73837 75438 77039 78640 80241 Storlekallel (bp)(nr) Storlekallel (bp)(nr) Storlekallel (bp)(nr) 403 bp? (+/- 8 bp) Ammie Berglund (ammie.berglund@bioresurs.uu.se)

15 Homo- eller heterozygot? • Beräkna andelen heterozygoter • Beräkna allelfrekvensen: antal alleler/totala antalet alleler (=2*antalet individer) • Testa Hardy Weinberg- jämvikt (p 2 +2pq+q 2 =1) (dock många alleler…) AHA – det är det som menas med heterozygot… Ammie Berglund (ammie.berglund@bioresurs.uu.se)

16 Fler tips på frågor att diskutera • Hur kan man förklara fenomenet att förekomsten av olika alleler skiljer sig mellan olika delar av världen? • Kan vi med hjälp av enbart D1S80 få några ledtrådar om vi försökte identifiera en person t ex i ett kriminalfall? • Vilka felkällor kan förklara att det inga band syns på gelen? • Tänkbara förklaringar för bandmönster med fler än två band? • Några etiska frågor som påverkar användningen av den här typen av genetiska markörer? • Vilka D1S80-genotyper kan avkomman få om du väljer två olika bandmönster från klassens resultat efter D1S80-analysen och antar att de skaffar barn tillsammans? Ingen betydelse om du tar två bandmönster som finns hos två personer av samma kön. Analysera vilka genotyper deras avkommor kan få! Ammie Berglund (ammie.berglund@bioresurs.uu.se)

17 Tidsplan Måndag 18 november Kl. 10.45-11.30Intro Barcoding-lab (DNA-prep start) Kl. 12.30-14.00/14.30–16.00 (byte Gr1/2) Grupp 1 – D1S80-lab DNA-extraktion, PCR-start, Gel-gjutning Grupp 2 – Barcoding-lab DNA-extraktion PCR-start Kl. 16-17 Info om ett webprojekt om GM-växter Tisdag 19 november Kl. 8.30-9.15Start gelelektroforeser Kl. 9.30-10.30Barcoding – datalab Kl. 10.30-11.30Gelavläsning/tolkning D1S80 Ammie Berglund (ammie.berglund@bioresurs.uu.se)


Ladda ner ppt "D1S80 – exempel på genetisk markör för studier av människa Bioresursdagar för gymnasielärare Uppsala 18-19 november 2013 Ammie Berglund www.bioresurs.uu.se."

Liknande presentationer


Google-annonser