Presentation laddar. Vänta.

Presentation laddar. Vänta.

Genkloning samt vektorsystem Annica Nordvall Bodell Molekylärbiologi T3 Ht-11.

Liknande presentationer


En presentation över ämnet: "Genkloning samt vektorsystem Annica Nordvall Bodell Molekylärbiologi T3 Ht-11."— Presentationens avskrift:

1 Genkloning samt vektorsystem Annica Nordvall Bodell Molekylärbiologi T3 Ht-11

2 Kunskapsmål för detta avsnitt Från kursplan: •redogöra för hur vektorer är konstruerade samt hur dessa kan användas för kloning och isolering av gensekvenser.

3 Lite mer utförligt •De olika stegen som ingår om man ska klona en DNA sekvens •Anledningar till att man vill klona gener eller andra sekvenser •Beskriva hur en plasmidvektor är uppbyggd och hur man kan arbeta med plasmidvektorer •Känna till bakteriofag lambda som vektor •Skillnad mellan eukaryota och prokaryota vektorsystem •Du bör också från detta avsnitt kunna förstå en enklare vektorkarta. Vad de olika ingående sekvenserna har för funktion och om vektorn kan användas i prokaryota eller eukaryota celler eller båda. •Vad genbibliotek innebär •Skillnad mellan genomiska bibliotek och cDNA bibliotek •Principen för hur man konstruerar respektive bibliotek •Hur man kan screena efter en specifik klon i ett bibliotek

4 Gene Cloning 1.1 Att klona en gen

5 Varför?

6 Hur gör man? 1. Klyvning med restriktionsenzym GC 4.1

7 GC 4.9 ”Blunt ends” och ”sticky ends”

8 2. Ligering med DNA-ligas GC 4.20

9 Korrekt ligering kan underlättas på olika sätt •Användning av linkers •Defosforylering av vektorn •Klyvning med två restriktionsenzymer

10 Linkers GC 4.21

11 3. Transformering av bakterier kan ske genom behandling med CaCl 2 och kyla eller mha elektroporering GC 5.3

12 Elektroporering Videolänk - genkloning

13 Prokaryota vektorsystem •Värdceller framförallt E.coli stammar •Vektorer: insert: –Plasmidvektorer/ 0-10kb Phagemid vektorer –Lambda vektorer 0-25kb/ -M13 vektorer ca 2kb –Cosmidvektorer kb –P1, PAC och BAC 0-300kb

14 Plasmidvektorer •Klonings- resp. expressionsvektorer •Lätta att rena och hantera •Kan användas för ett stort antal applikationer tex. protein-uttryck, sekvensering, probe framställning, in vitro mutagenes mm •Många plasmidvektorer innehåller sekvenser som gör att vektorn (och insert) kan fås enkelsträngad = Phagemide vektorer

15 Ex. kloningsvektor med två selektionsmarkörer GC 5.9

16 För att uttrycka protein krävs en expressionsvektor

17 Lambda vektorer •Används framförallt till bibliotek (då man arbetar med många kloner) •Insert upp till ca 25kb •Fagens egen infektionscykel utnyttjas för att få många kopior

18 Lambda infektion GC 2.6 Videolänk

19 Bakteriofag-kloner bildar plack GC 5.12

20 Eukaryota vektorsystem •Värdceller och värdorganismer som man är intresserad av att studera eller som fungerar för proteinproduktion •Plasmidvektorer eller virusbaserade vektorer •Transient expression– vektorn integreras ej, fungerar under kortare tid •Stabil expression– vektorn integreras i någon av värdcellens kromosomer

21 Ex. plasmidvektor för expression i eukaryota celler (HMG 5.23)

22 Transfektion av eukaryota celler leder till transient eller stabil expression The Cell 3.35

23 Ex 1 plasmidvektor MCS (eller polylinker)

24 Ex 2 plasmidvektor

25 Genbibliotek kan användas för att hitta en gen/sekvens som ej tidigare har isolerats Man skiljer på två olika typer av bibliotek: •Genomiska bibliotek •cDNA bibliotek

26 Genomiska bibliotek •Hela genomet delas upp i kortare fragment (ca 15kb) mha restriktionsenzym •Varje fragment ligeras in i en vektor •Alla vektorer transformeras in i värdceller och får växa till och bilda kloner (=biblioteket) •Här återfinns alltså alla sekvenser som finns i ett genom •Hur många kloner blir det???

27 Genomiskt bibliotek Videolänk

28 cDNA bibliotek •Utgår från det mRNA som återfinns i en celltyp •Omvandlar mRNA till dsDNA mha omvänt transkriptas =cDNA •Ligerar in alla cDNA sekvenser i vektorer •Alla vektorer transformeras in i värdceller och får växa till och bilda kloner (=biblioteket) •Här återfinns alltså alla sekvenser som uttryckts i form av mRNA i en viss celltyp •Hur många kloner blir det??? Jämför med ett genomiskt bibliotek

29 Konstruktion av cDNA-bibliotek GC 8.7

30 För att hitta rätt gen i ett bibliotek måste man screena biblioteket GC 5.2, se även 8.1

31 Screening med hjälp av DNA probe GC 8.9

32 Hur kan man få en DNA probe? •Syntetisera oligonukleotider utifrån en aminosyrasekvens •Använda en besläktad (redan isolerad) sekvens som probe

33 Syntes av oligonukleotider utifrån aminosyrasekvens Cys- Met-Asp- Glu-Me-.Lys-Arg-Asn-Ile TGC/T-ATG-GAC/T- GAG/A-ATG-AAA/G-AGA/G-AAC/T-ATT/A/C eller CGC/A/G/T Degenererad probe 8 olika varianter (17b) TGC/T-ATG-GAC/T-GAG/A-ATG-AA Unik ”guessmer” (27b) TGCATGGACGAGATGAAGCGCAACATC


Ladda ner ppt "Genkloning samt vektorsystem Annica Nordvall Bodell Molekylärbiologi T3 Ht-11."

Liknande presentationer


Google-annonser